|
|
|
We now have new primers to our supply, they are highlighted in red.
We still as always provide the pUC/M13 forward and reverse, SP6 promoter,
and T7 promoter primers for sequencing reactions at no additional charge. The
sequences of these primers are: SP6 Promoter 5' -GATTTAGGTGACACTATAG-3' PGEX-5 5-GGGCTGGCAAGCCACGTTTGGTG-3 PGEX-3 5-CCGGGAGCTGCATGTGTCAGAGG MP18/pUC18 (-48)Rev 5-AGCGGATAACAATTTCACACAGGA-3 T3 seq (20 mer) 5-ATTAACCCTCACTAAAGGGA-3 T3 promoter 5-TAACCCTCACTAAAGGGA-3 T7 Terminator 5CTAGTTATTGCTCAGCGGTG PGEX-Forward 5-GCATGGCCTTTGCAGGGCTG EGFP N 5-CGTCGCCGTCCAGCTCGACCAG-3 EGFP C 5-CATGGTCCTGCTGGAGTTCGTG-3 PCDM8 reverse 5-CCTCTAGAGTCGCGGCCGCGACCTGCAG-3 Firefly luciferase upstream 5-GGATAGAATGGCGCCGG-3 Lambda gt 10 forward 5-AGCAAGTTCAGCCTGGTTAAG-3 Lambda gt10 reverse 5-CTTATGAGTATTTCTTCCAGGGTA-3 Lambda gt11 forward 5-GGTGGCGACGACTCCTGGAGCCCG-3 Lambda gt11 reverse 5-TTGACACCAGACCAACTGTAATG-3 SV40 (Clockwise) 5-TGTTTCGGCGTGGGTATG-3 SV40 (Counterclockwise) 5-AGCGAGGAAGCGGAAGAG-3If you are submitting samples that require the use of these primers, please verify that your plasmids have the appropriate primer binding site. In particular, some plasmids with SP6 or T7 promoters may lack part of the sequence required for binding the SP6 and T7 primers listed above. If you are supplying your own primers, they should have a Tm between 50 degrees C and 65 degrees C, should be 18- 22 nt in length, and lack potential secondary structure. Tm calculations are often provided for you by the oligonucleotide supplier, or they can be calculated using a javascript interface at Promega's website http://www.promega.com/BioMath . A program and web site for evaluating potential primers are listed on our links page. |
|
Send mail to
service@nwdna.com with
questions or comments about this web site.
|